View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14212_high_14 (Length: 320)
Name: NF14212_high_14
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14212_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 15)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 148 - 257
Target Start/End: Complemental strand, 8260644 - 8260535
Alignment:
| Q |
148 |
gagctccaattgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcatgcagtattaatctgcatccactttcttatcaagagactag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8260644 |
gagctccaattgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcatgcagtattaatctgcatccactttcttatcaagagactag |
8260545 |
T |
 |
| Q |
248 |
agcaatcgac |
257 |
Q |
| |
|
|||||||||| |
|
|
| T |
8260544 |
agcaatcgac |
8260535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 8260791 - 8260709
Alignment:
| Q |
1 |
actttttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatgat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8260791 |
actttttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatgat |
8260709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 83
Target Start/End: Complemental strand, 8265755 - 8265675
Alignment:
| Q |
3 |
tttttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatgat |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8265755 |
ttttttatggctttgatttcatccttcttaagttgctttggccattctttagactcatcgtctcaagtttctgattatgat |
8265675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 3 - 83
Target Start/End: Complemental strand, 8258682 - 8258602
Alignment:
| Q |
3 |
tttttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatgat |
83 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8258682 |
ttttttatggctttgatttcatccattttaagttgctttggccattcttcaaactcatcatctcaagtttctgattatgat |
8258602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 8350076 - 8350014
Alignment:
| Q |
148 |
gagctccaattgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcatgca |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
8350076 |
gagctccaattatagtttcttatttccctgttaactattatccctcacgcttgtagtcatgca |
8350014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 8350205 - 8350129
Alignment:
| Q |
1 |
actttttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgat |
77 |
Q |
| |
|
||||||||||||||||||||||||| ||||| | ||| ||||| | ||||| | ||||||| ||||||||||||||| |
|
|
| T |
8350205 |
actttttgatggctttgatttcatcattcttcaattgttttggtccttcttcaaactcatcttctcaagtttctgat |
8350129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 148 - 207
Target Start/End: Complemental strand, 8258537 - 8258478
Alignment:
| Q |
148 |
gagctccaattgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcat |
207 |
Q |
| |
|
|||||||||||||||| | | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8258537 |
gagctccaattgtagtatatcatttccctactaactcttatctctcacgtttgtagtcat |
8258478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 148 - 207
Target Start/End: Complemental strand, 8265610 - 8265551
Alignment:
| Q |
148 |
gagctccaattgtagtttcttatttccctgttaactcttatctctcacgtttgtagtcat |
207 |
Q |
| |
|
|||||||||||||||| | | ||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8265610 |
gagctccaattgtagtatatcatttccctgctaactcttatctctctcgtttgtagtcat |
8265551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 8352949 - 8352867
Alignment:
| Q |
1 |
actttttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatgat |
83 |
Q |
| |
|
||||||||||||||||||||||||| || || | ||||||||| | ||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
8352949 |
actttttgatggctttgatttcatcatttttcaattgctttggtccttcttcgaactcatcttctcaagtttatgattatgat |
8352867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 6 - 77
Target Start/End: Complemental strand, 8253046 - 8252975
Alignment:
| Q |
6 |
ttgatggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgat |
77 |
Q |
| |
|
|||||||||||||||||||| ||||| | ||| ||||| | ||||| | ||||||| ||||||||||||||| |
|
|
| T |
8253046 |
ttgatggctttgatttcatcattcttcaattgttttggtccttcttcaaactcatcttctcaagtttctgat |
8252975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 152 - 222
Target Start/End: Complemental strand, 8334073 - 8334002
Alignment:
| Q |
152 |
tccaattgtagtttcttatttccctgttaactcttat-ctctcacgtttgtagtcatgcagtattaatctgc |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| | |||||| ||||||||| || |||||||||||| |
|
|
| T |
8334073 |
tccaattgtagtttcttatttcctcgttaactattatcccctcacgcttgtagtcaggcggtattaatctgc |
8334002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 8352802 - 8352761
Alignment:
| Q |
148 |
gagctccaattgtagtttcttatttccctgttaactcttatc |
189 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8352802 |
gagcttcaattgtagtttcttatttccctgttaactattatc |
8352761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 8356508 - 8356436
Alignment:
| Q |
9 |
atggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatg |
81 |
Q |
| |
|
||||||||||||| | | ||||| | ||||||||| | |||| | ||||||||||||||||||||||||||| |
|
|
| T |
8356508 |
atggctttgattttaccgttcttcaattgctttggtctctcttcaaactcatcatctcaagtttctgattatg |
8356436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 8252922 - 8252867
Alignment:
| Q |
148 |
gagctccaattgtagtttcttatttccctgttaactcttatctctcacgtttgtag |
203 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| || ||||||||| |||||| |
|
|
| T |
8252922 |
gagctccaattgcagtttcttatttctctgttaacaattgtctctcacgcttgtag |
8252867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 8360681 - 8360609
Alignment:
| Q |
9 |
atggctttgatttcatccttcttaagttgctttggccattctttagactcatcatctcaagtttctgattatg |
81 |
Q |
| |
|
||||||||||||||| | ||||| | |||||| || | |||| | ||| ||||||||||||||||||||||| |
|
|
| T |
8360681 |
atggctttgatttcagctttcttcaattgcttcggtctctcttcaaacttatcatctcaagtttctgattatg |
8360609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University