View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14212_high_19 (Length: 244)
Name: NF14212_high_19
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14212_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 48999751 - 48999532
Alignment:
| Q |
8 |
aaaggcggagaagctattggatcttctgaacatacaggtgcatgaaacaaatgcggaatcgaagaagaaagaagagacattaacggagatgaagcatgtg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48999751 |
aaagacggagaagctattggatcttctgaacatacaggtgcatgaaacaaatgcggaatcgaagaagaaagaagagacattaacggagatgaagcatgtg |
48999652 |
T |
 |
| Q |
108 |
gttaaggatttacgtgaagaagactcgacgaagcggcgaatagcggcggcgagagtaagatcactgacgaaagaagattccgaagcgagaggctcactcg |
207 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48999651 |
gttaaggatttacgcggagaagactcgacaaagcggcgaatagcggcagcgagagtaagatcactgacgaaagaagattccgaagcgagaggctcactcg |
48999552 |
T |
 |
| Q |
208 |
caatgctcggggctatttct |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48999551 |
caatgctcggggctatttct |
48999532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University