View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14212_high_23 (Length: 207)
Name: NF14212_high_23
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14212_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 41720914 - 41720987
Alignment:
| Q |
123 |
gggttagggtttatggttgaaaaaacaactgtgaagaaatgaatggtaaactagtactaacttctaagtgatga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720914 |
gggttagggtttatggttgaaaaaacaactgtgaagaaatgaatggtaaactagtactaacttctaagtgatga |
41720987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University