View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14212_low_17 (Length: 283)
Name: NF14212_low_17
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14212_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 8179735 - 8179686
Alignment:
| Q |
219 |
atggagtgcaagttc---atttccttgctggctgaatcttgacgagttgt |
265 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8179735 |
atggagtgcaagttcttcatttccttgctggctgaatcttgacgagttgt |
8179686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 106 - 145
Target Start/End: Complemental strand, 8195527 - 8195488
Alignment:
| Q |
106 |
aaaattgatttacggaaaagttcattctcataacgtttta |
145 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8195527 |
aaaattgatttaaggaaaagttcattctcataacgtttta |
8195488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 78
Target Start/End: Complemental strand, 8195621 - 8195579
Alignment:
| Q |
36 |
ataaatgaatttcatcaaatgtatgtgctacctgattgttttt |
78 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8195621 |
ataaatgaatttcaacaaatgtatgtgctacctaattgttttt |
8195579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 8195719 - 8195687
Alignment:
| Q |
2 |
tggaaaaagtaatagtcaaaaaataaatcattt |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8195719 |
tggaaaaagtaatagtcaaaaaataaatcattt |
8195687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University