View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14212_low_20 (Length: 244)

Name: NF14212_low_20
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14212_low_20
NF14212_low_20
[»] chr3 (1 HSPs)
chr3 (8-227)||(48999532-48999751)


Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 48999751 - 48999532
Alignment:
8 aaaggcggagaagctattggatcttctgaacatacaggtgcatgaaacaaatgcggaatcgaagaagaaagaagagacattaacggagatgaagcatgtg 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48999751 aaagacggagaagctattggatcttctgaacatacaggtgcatgaaacaaatgcggaatcgaagaagaaagaagagacattaacggagatgaagcatgtg 48999652  T
108 gttaaggatttacgtgaagaagactcgacgaagcggcgaatagcggcggcgagagtaagatcactgacgaaagaagattccgaagcgagaggctcactcg 207  Q
    |||||||||||||| | |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
48999651 gttaaggatttacgcggagaagactcgacaaagcggcgaatagcggcagcgagagtaagatcactgacgaaagaagattccgaagcgagaggctcactcg 48999552  T
208 caatgctcggggctatttct 227  Q
    ||||||||||||||||||||    
48999551 caatgctcggggctatttct 48999532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University