View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14212_low_23 (Length: 226)
Name: NF14212_low_23
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14212_low_23 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 174
Target Start/End: Original strand, 33718048 - 33718204
Alignment:
| Q |
18 |
cttacataattgtttgattactaatttcttacatgaacaattatgtagctcaaattttgatatcataactcctgaattgtatgaactaaaaatatctatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718048 |
cttacataattgtttgattactaatttcttacatgaacaattatgtagctcaaattttgatatcataactcctgaattgtatgaactaaaaatatctatc |
33718147 |
T |
 |
| Q |
118 |
tagtctattaataattttagaattcattataatgtgataagcttagctcaactcaac |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33718148 |
tagtctattaataattttagaattcattacaatgtgataagcttagctcaactcaac |
33718204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 165
Target Start/End: Complemental strand, 63118 - 63081
Alignment:
| Q |
128 |
ataattttagaattcattataatgtgataagcttagct |
165 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
63118 |
ataattttagaattcattacagtgtgataagcttagct |
63081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University