View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14212_low_24 (Length: 207)

Name: NF14212_low_24
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14212_low_24
NF14212_low_24
[»] chr1 (1 HSPs)
chr1 (123-196)||(41720914-41720987)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 41720914 - 41720987
Alignment:
123 gggttagggtttatggttgaaaaaacaactgtgaagaaatgaatggtaaactagtactaacttctaagtgatga 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41720914 gggttagggtttatggttgaaaaaacaactgtgaagaaatgaatggtaaactagtactaacttctaagtgatga 41720987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University