View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14212_low_8 (Length: 423)
Name: NF14212_low_8
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14212_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 33796235 - 33796292
Alignment:
| Q |
18 |
ataatcttctatgtttataagctattattaacctcgatttccaaagaatataggactt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33796235 |
ataatcttctatgtttataagctattattaacctcgatttccaaagaatataggactt |
33796292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University