View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14215_high_2 (Length: 303)
Name: NF14215_high_2
Description: NF14215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14215_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 30347619 - 30347557
Alignment:
| Q |
18 |
acataatcttatctacaataggtttatggacacatttctttctaaacaatgtgaactttgaaa |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30347619 |
acataatcttatctacaataggtttatggacacatttctttctaaacaatgtgaactttgaaa |
30347557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 195 - 249
Target Start/End: Complemental strand, 24750553 - 24750499
Alignment:
| Q |
195 |
tatgagaaaagagggaagtatagaaaaagtacccatcaaggggccaagtgaagag |
249 |
Q |
| |
|
|||||| | |||||||| ||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24750553 |
tatgagcatagagggaaatatggaaaaagtatccatcgaggggccaagtgaagag |
24750499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University