View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14215_high_5 (Length: 264)
Name: NF14215_high_5
Description: NF14215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14215_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 264
Target Start/End: Complemental strand, 7258337 - 7258082
Alignment:
| Q |
9 |
agcagagagatttatcatactaaaagaatgcaaaggttcactcaatatacatattgtgcactgaacattctgttgtgtttaattgtccgcttaacttttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7258337 |
agcagagagatttatcatactaaaagaatgcaaaggttcactcaatatacatattgtgcactgaacattctgttgtgtttaattgtccgcttaacttttc |
7258238 |
T |
 |
| Q |
109 |
gaacgatacatacctcagctgtttaaaagatttcttttgctgtttgtgtcgagtttatggaaatattcttatcttgctctatggcagctaatcttcttct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7258237 |
gaacgatacatacctcagctgtttaaaagatttcttttgctgtttgtgtcgagtttatggaaatattcttatcttgctctatggcagctaatcttcttct |
7258138 |
T |
 |
| Q |
209 |
tttgttcacagggtattctgtgtcaagttcagtggcgatggtagttttgttatttc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
7258137 |
tttgttcacagggtattctgtgtcaagttcagtggcgatggaagttatgttatttc |
7258082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University