View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14215_low_7 (Length: 247)
Name: NF14215_low_7
Description: NF14215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14215_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 40925068 - 40924837
Alignment:
| Q |
13 |
ttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacagtccaactttcttaaaatggctgcgttcacctcccaaacc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925068 |
ttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacggtccaactttcttaaaatggctgcgttcacctcccaaacc |
40924969 |
T |
|
| Q |
113 |
accacgggcagcggtggcacctttgcccctcactgagttgaacgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatgcaggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40924968 |
accacgggcagcggtggcacctttgcccctcactgagttg-acgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatacaggt |
40924870 |
T |
|
| Q |
213 |
aacaacaagtacatttctttgatgatgtccatc |
245 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |
|
|
| T |
40924869 |
aacaacaagtacatttctttgaggatgttcatc |
40924837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University