View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14215_low_8 (Length: 243)
Name: NF14215_low_8
Description: NF14215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14215_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 234
Target Start/End: Original strand, 25919581 - 25919810
Alignment:
| Q |
4 |
ttatactatatgtttctgaaatctcaatacatcatagattcatagctcaaattaaaatcacatttaaaattgttttttaatttgattatacaccatgtag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
25919581 |
ttatactatatgtttctgaaatctcaatacatcatagattcatagctcaaattaaaatcacatttaaaattgttttttaatttgattatatactatgtag |
25919680 |
T |
 |
| Q |
104 |
tatgttatttataaaagaaaaatacacttaattattccactaaatatactatatactagtatttattcagattgtttagtaaatnnnnnnnnntcaggct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||| |
|
|
| T |
25919681 |
tatgttatttataaaagaaaaatacacttaattattccactaaatatactatatactagtattaattcagattgtttagtgaat-aaaaaaaatcaggct |
25919779 |
T |
 |
| Q |
204 |
ggttagaactgtttgattaagagctagaagc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25919780 |
ggttagaactgtttgattaagagctagaagc |
25919810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University