View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14215_low_9 (Length: 201)
Name: NF14215_low_9
Description: NF14215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14215_low_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 9828131 - 9828307
Alignment:
| Q |
17 |
gaacacacataagaaaggaacaacacacgttaagatgttgtttcctnnnnnnncaaattaaatagcacgaccatatgaaatattatgcccccctatggct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
9828131 |
gaacacacataagaaaggaacaacacacgttaagatgttgtttcctaaaaaaacaaattaaatagcacgaccgtatgaaatattatgcccc--tatggcc |
9828228 |
T |
 |
| Q |
117 |
ctataactcctatgtggtagggcatttttcaaccgaatcaagtagttaatcgaaatagcacaggtatacacatttgtttaatttc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9828229 |
ctataactcctatgtggtagggcatttttcaaccgaatcaagtaattaatcga------acatgtatacacatttgtttaatttc |
9828307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University