View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14216_high_15 (Length: 265)
Name: NF14216_high_15
Description: NF14216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14216_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 45818448 - 45818219
Alignment:
| Q |
20 |
gataaagtgtgcatcatgaggatgggtgggggcccaatttgattggacttgtagttgatttgacatttcacatcaggctcgataaggattggcattcccg |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45818448 |
gataaagtgtgcagcatgaggatgggtgggggcccaatttgattggacttgtagttgatttgacatttcacatcaggctcgataaggattggcattcccg |
45818349 |
T |
 |
| Q |
120 |
tgtgcgtgtggtgtagtttttctgttcttttcgattgcaaaattacactaatctcagttcaccagcgttaagatcttaattaagagaatgaaaatgaaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45818348 |
tgtgcgtgtggtgtagtttttctgttcttttcgattgcaaaattacactaatctcagttcaccagcgttaagatcttaattaagagaatgaaaatgaaag |
45818249 |
T |
 |
| Q |
220 |
acatgcatttttattatttctctaatctta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45818248 |
gcatgcatttttattatttctctaatctta |
45818219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University