View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14216_low_12 (Length: 373)
Name: NF14216_low_12
Description: NF14216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14216_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 13115612 - 13115250
Alignment:
| Q |
1 |
aatggaagatgtatagaataatatccacgccggcatccaagttccgccaattccggcgactcggttctaaacaaaccatcacctcctccactcaagaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
13115612 |
aatggaagatgtatagaataatatccacgccggcatccaagttccgccaattccggcgactcggttctaaaccaaccatcacctcctccactgaagaaga |
13115513 |
T |
 |
| Q |
101 |
agaacaagcttcacatattctactatggcggtaccagatcctggacccggacagcgagttggttgcatattggaacaaagtcttccttgttatgagtctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13115512 |
agaacaagcttcacatattctactatggcggtaccagatcctggacccggacagcgagttggttgcatattggaacaaagtcttccttgttacgagtctc |
13115413 |
T |
 |
| Q |
201 |
ctcgcattgttcgtagatcctctttatttcttcctaccgacggttggtggacccgcttgcttgtcggttgatcctaaactaagcatcgtgataacctttc |
300 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
13115412 |
ctcgcattgttcatagatcctctttatttcttcctaccgacggttggcggacccgcttgcttgtcggtggatcctaaactaagcatcgtcataacctttc |
13115313 |
T |
 |
| Q |
301 |
ttagaacgtttgcggatttgttttatgttcttcatatggttatgaagtttcggacggcctttg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13115312 |
ttagaacgtttgcggatttgttttatgttcttcatatggttatgaagtttcggacggcttttg |
13115250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University