View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14217_high_13 (Length: 231)
Name: NF14217_high_13
Description: NF14217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14217_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 28 - 204
Target Start/End: Complemental strand, 36526621 - 36526445
Alignment:
| Q |
28 |
agaattaccctcctacatgttgaatttcttgatcattctctctttannnnnnnaagacttttttatgtgttgtataaactaaatacttttatctttacct |
127 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36526621 |
agaatgaccctcctacatgttgaatttcttgatcattttctctttatttttttaagacttttttatgtgttgtataaaataaatacttttatctttacct |
36526522 |
T |
 |
| Q |
128 |
tgatatttatggcatatatattcattgtagtaatctccnnnnnnnnnnnnggattcggtgttggtcaacatttatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36526521 |
tgatatttatggcatatatattcattgtagtaatctccttttttttttttggattcggtgttggtcaacatttatct |
36526445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University