View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14219_high_12 (Length: 209)
Name: NF14219_high_12
Description: NF14219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14219_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 1790744 - 1790925
Alignment:
| Q |
12 |
gagatgaagcagagctgtttgaattcacaacagacgaaggtgagggtgattatcttaaattgttgcattggttcactctctcctattaatttgtttttat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1790744 |
gagatgaagcagagctgtttgaattcacaacagacgaaggtgagggtgattatcttaaattgttgcattggttcactctctcctattaatttgtttttat |
1790843 |
T |
 |
| Q |
112 |
actaaccaacgaaagtgaatgtctgttgtgttgagcagcgcaagtgactagagggcttgatagagctgtaatgagtatgaag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1790844 |
actaaccaacgaaagtgaatgtctgttgtgttgagcagcgcaagtgactagagggcttgatagagctgtaatgagtatgaag |
1790925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 3495423 - 3495389
Alignment:
| Q |
14 |
gatgaagcagagctgtttgaattcacaacagacga |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3495423 |
gatgaagcagagctgtttgaattcacaacagacga |
3495389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 124 - 185
Target Start/End: Complemental strand, 3495319 - 3495258
Alignment:
| Q |
124 |
aagtgaatgtctgttgtgttgagcagcgcaagtgactagagggcttgatagagctgtaatga |
185 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||| | ||||| |||||||||||||||| |
|
|
| T |
3495319 |
aagtgaatgtttgttgtattgagcagagcaagtgattgatgggctcgatagagctgtaatga |
3495258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University