View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14219_low_12 (Length: 218)

Name: NF14219_low_12
Description: NF14219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14219_low_12
NF14219_low_12
[»] chr4 (1 HSPs)
chr4 (1-218)||(53597450-53597667)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 53597667 - 53597450
Alignment:
1 tggtgggctagtcaaagaaaaccagattgcaaagtggaacattcttttcctgaagatggtttcaaattaggagagaatatatattggggtagtggctctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53597667 tggtgggctagtcaaagaaaaccagattgcaaagtggaacattcttttcctgaagatggtttcaaattaggagagaatatatattggggtagtggctctg 53597568  T
101 attggacaccaacggatgctgtaaaagcttgggctgatgaagagaaatattacacatatgtgactaattcatgtgtatctggtcaaatgtgtggacatta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53597567 attggacaccaacggatgctgtaaaagcttgggctgatgaagagaaatattacacatatgtgactaattcatgtgtatctggtcaaatgtgtggacatta 53597468  T
201 tactcagattgtgtggaa 218  Q
    ||||||||||||||||||    
53597467 tactcagattgtgtggaa 53597450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University