View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14219_low_12 (Length: 218)
Name: NF14219_low_12
Description: NF14219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14219_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 53597667 - 53597450
Alignment:
| Q |
1 |
tggtgggctagtcaaagaaaaccagattgcaaagtggaacattcttttcctgaagatggtttcaaattaggagagaatatatattggggtagtggctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53597667 |
tggtgggctagtcaaagaaaaccagattgcaaagtggaacattcttttcctgaagatggtttcaaattaggagagaatatatattggggtagtggctctg |
53597568 |
T |
 |
| Q |
101 |
attggacaccaacggatgctgtaaaagcttgggctgatgaagagaaatattacacatatgtgactaattcatgtgtatctggtcaaatgtgtggacatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53597567 |
attggacaccaacggatgctgtaaaagcttgggctgatgaagagaaatattacacatatgtgactaattcatgtgtatctggtcaaatgtgtggacatta |
53597468 |
T |
 |
| Q |
201 |
tactcagattgtgtggaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53597467 |
tactcagattgtgtggaa |
53597450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University