View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14219_low_13 (Length: 209)

Name: NF14219_low_13
Description: NF14219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14219_low_13
NF14219_low_13
[»] chr8 (3 HSPs)
chr8 (12-193)||(1790744-1790925)
chr8 (14-48)||(3495389-3495423)
chr8 (124-185)||(3495258-3495319)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 1790744 - 1790925
Alignment:
12 gagatgaagcagagctgtttgaattcacaacagacgaaggtgagggtgattatcttaaattgttgcattggttcactctctcctattaatttgtttttat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1790744 gagatgaagcagagctgtttgaattcacaacagacgaaggtgagggtgattatcttaaattgttgcattggttcactctctcctattaatttgtttttat 1790843  T
112 actaaccaacgaaagtgaatgtctgttgtgttgagcagcgcaagtgactagagggcttgatagagctgtaatgagtatgaag 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1790844 actaaccaacgaaagtgaatgtctgttgtgttgagcagcgcaagtgactagagggcttgatagagctgtaatgagtatgaag 1790925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 3495423 - 3495389
Alignment:
14 gatgaagcagagctgtttgaattcacaacagacga 48  Q
    |||||||||||||||||||||||||||||||||||    
3495423 gatgaagcagagctgtttgaattcacaacagacga 3495389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 124 - 185
Target Start/End: Complemental strand, 3495319 - 3495258
Alignment:
124 aagtgaatgtctgttgtgttgagcagcgcaagtgactagagggcttgatagagctgtaatga 185  Q
    |||||||||| |||||| |||||||| |||||||| |   ||||| ||||||||||||||||    
3495319 aagtgaatgtttgttgtattgagcagagcaagtgattgatgggctcgatagagctgtaatga 3495258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University