View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1421_low_17 (Length: 205)
Name: NF1421_low_17
Description: NF1421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1421_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 44 - 185
Target Start/End: Original strand, 34094034 - 34094175
Alignment:
| Q |
44 |
aatatgtgatcacgaggggttgcgcaaaatcaatatcaataaaaatatgagcaatgtggcccatgtatttggaattgcttgcttcattcaatgataagga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34094034 |
aatatgtgatcacgaggggttgcgcaaaatcaatatcaataaaaacatgagcaatgtggcccatgtatttggaattgcttgcttcattcaatgataagga |
34094133 |
T |
|
| Q |
144 |
gcctccatattagaagaaattgtaaatttttggcctccagta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34094134 |
gcctccatattagaagaaattgtaaatttttggcctccagta |
34094175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University