View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422-Insertion-31 (Length: 121)
Name: NF1422-Insertion-31
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422-Insertion-31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 34730397 - 34730283
Alignment:
| Q |
7 |
atcttggactaacacctcattgctaaaagttagtccatcatggaccaaaacagatgattccaattttaagttcgtcaaatcaacttaaaaaagaattaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34730397 |
atcttggactaacacctcattgctaaaagttagttcatcatggaccaaaacagatgattccaattttaagttcgtcaaatcaacttaaaaaaagattaaa |
34730298 |
T |
|
| Q |
107 |
attagagctgtttga |
121 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
34730297 |
attagagttgtttga |
34730283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University