View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422-Insertion-32 (Length: 110)
Name: NF1422-Insertion-32
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422-Insertion-32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 6805758 - 6805656
Alignment:
| Q |
8 |
gcaacaaatgtatgtgataattctgtatcaggtgaagaagttttggaaaatgggagaagttatagagaagcaagcaaatggttatcagagtatatgttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6805758 |
gcaacaaatgtatgtgataattctgtataaggtgaagaagttttggaaaatgggagaagttatagagaagcaagcaaatggttatcagagtatatgttat |
6805659 |
T |
|
| Q |
108 |
atc |
110 |
Q |
| |
|
||| |
|
|
| T |
6805658 |
atc |
6805656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 4e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 7327910 - 7327802
Alignment:
| Q |
8 |
gcaacaaatgtatgtgataattctgtatcaggtgaagaagttttggaaaatgggag------aagttatagagaagcaagcaaatggttatcagagtata |
101 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||| ||||||||||||||||| || || |||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
7327910 |
gcaacaaatatatgttataattctgaatcagacgaagaagttttggaaaagggaagggttttaagttataaagaagcaagcaaatgtttatcagagtata |
7327811 |
T |
|
| Q |
102 |
tgttatatc |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
7327810 |
tgttatatc |
7327802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University