View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14221_high_8 (Length: 255)
Name: NF14221_high_8
Description: NF14221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14221_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 24134368 - 24134250
Alignment:
| Q |
127 |
ttattttattttattcagtacctttaaaaacaatttcaatttttaatatttcactttcatatg------tataatattgttgaatcatgtctagggagaa |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24134368 |
ttattttattttattcagtacccttaaaaacaatttcaatttttaatatttcactttcatatgtatatgtataatatggttgaatcatgtctagggagaa |
24134269 |
T |
|
| Q |
221 |
acctacacatgcagtttct |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24134268 |
acctacacatgcagtttct |
24134250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 13 - 107
Target Start/End: Complemental strand, 24134880 - 24134786
Alignment:
| Q |
13 |
catcaattgttcaacttccatctctaaggtaaagttttgtttgatattatctataacttggtataatttcaaaattatttatccatggtattttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24134880 |
catcaattgttcaacttccatctctaaggtaaaattttgtttgatattatctataacttggtataatttcaaaattatttacacatggtattttt |
24134786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 168 - 239
Target Start/End: Complemental strand, 19756558 - 19756487
Alignment:
| Q |
168 |
tttaatatttcactttcatatgtataatattgttgaatcatgtctagggagaaacctacacatgcagtttct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
19756558 |
tttaatatttcactttcatatgtataatatggttgaatcatgtccagggagaaacctacacttgcagtttct |
19756487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University