View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14221_low_6 (Length: 327)

Name: NF14221_low_6
Description: NF14221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14221_low_6
NF14221_low_6
[»] chr2 (1 HSPs)
chr2 (57-151)||(43502337-43502431)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 57 - 151
Target Start/End: Original strand, 43502337 - 43502431
Alignment:
57 acaggttgatctaacctaaagtaaatatgtggcagtgccacgtcacttgaaatgcacacgtaatgctgccacatcagcatatagagaagttgaga 151  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
43502337 acaggttgatctaacctaaactaaatatgtggcagtgccacgtcacttgaaattcacacgtaatgctgccacatcagcatatagagaagttgaga 43502431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University