View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14222_high_18 (Length: 246)
Name: NF14222_high_18
Description: NF14222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14222_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 28893395 - 28893202
Alignment:
| Q |
25 |
gcaagttactttatttaattatataatggttactttatcaaaccattgttaatagattaatattaattctaacattttatccaaagcatggtataagatt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
28893395 |
gcaagttactttatttaattatataatggttactttatcaaaccattgttaatagattaatat-aattctaacatt---------gcatggtaaaagatt |
28893306 |
T |
 |
| Q |
125 |
aagataatttcatcatgatgnnnnnnngaagggcatagccagaaaatcgaattatgttccaacgttgaagacagcctctccatgtatcaaagctggtccc |
224 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28893305 |
aagataatttcatcatgatgaaaaaaagaagggcatagccagaaaatcgaattatgttccaacgttgaagacaagctctccatgtatcaaagctggtccc |
28893206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University