View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14222_low_14 (Length: 355)
Name: NF14222_low_14
Description: NF14222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14222_low_14 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 128 - 355
Target Start/End: Complemental strand, 41875190 - 41874963
Alignment:
| Q |
128 |
actagaatcaactactatatggtaagaaaattactctttcttgctaaagaaagagtatattttgtttgtttctaccgaaagattatatacttattatagt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41875190 |
actagaatcaactactatatggtaagaaaattactctttcttgctacagaaagagtatattttgtttgtttctacagaaagattatatacttattatagt |
41875091 |
T |
|
| Q |
228 |
gtggattgtggaacttttctatgtgcgttgcacaaaccacaaaccatgtccgtgacagaggaaactgtctgagagagacaaattaaaggggatcagagaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
41875090 |
gtggattgtggaacttttctatgtgcgttgcacaaaccacaaaccatgtccgtgacagaggaaactttctgagagagacaaattaagggggattagagaa |
41874991 |
T |
|
| Q |
328 |
tctacataatggaggacaaatattgaaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
41874990 |
tctatataatggaggacaaatattgaaa |
41874963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 59
Target Start/End: Complemental strand, 41875304 - 41875258
Alignment:
| Q |
13 |
agaacctgtgtcacacattcaataaaatgtccaattaattcactaac |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41875304 |
agaacctgtgtcacacattcaataaaatgtccaattaattcaataac |
41875258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University