View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14222_low_22 (Length: 239)
Name: NF14222_low_22
Description: NF14222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14222_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 36857384 - 36857535
Alignment:
| Q |
1 |
tcaatttcttcaaacgcatctcaccagaccaaccattaatatgaagaaataaatttgacggtgtgatgacgttgaattgaaatgaattgaaaccacctca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36857384 |
tcaatttcttcaaatgcatctcaccagaccaaccattaatatgaagaaataaatttgacggtgtgatgacgttgaattgaaatgaattgaaaccacctca |
36857483 |
T |
 |
| Q |
101 |
tcacctccaaccaaactctagatgtcactctactatgtaaaaacaaatgcac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36857484 |
tcacctccaaccaaactctagatgtcactctactatgtaaaaacaaatgcac |
36857535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 150 - 221
Target Start/End: Original strand, 36857562 - 36857633
Alignment:
| Q |
150 |
cacaaacctcttagagtcatcaactgccaaaagatgtcttctcaagattaaccttagttggaatgtgaccaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36857562 |
cacaaacctcttagagtcatcaactgccaaaagatgtcttctcaagattaaccttagttggaatgcgaccaa |
36857633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 143
Target Start/End: Original strand, 27895295 - 27895354
Alignment:
| Q |
84 |
gaattgaaaccacctcatcacctccaaccaaactctagatgtcactctactatgtaaaaa |
143 |
Q |
| |
|
|||||| | ||||| |||||| |||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
27895295 |
gaattgcagccaccgcatcacatccaaccaaactctagatatcactcgacaatgtaaaaa |
27895354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University