View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14222_low_26 (Length: 221)

Name: NF14222_low_26
Description: NF14222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14222_low_26
NF14222_low_26
[»] chr5 (2 HSPs)
chr5 (32-143)||(36209646-36209757)
chr5 (152-206)||(36209557-36209611)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 32 - 143
Target Start/End: Complemental strand, 36209757 - 36209646
Alignment:
32 tcatgccaattttcttcaaaaatattgaccaagatagtcccttttcgtaagattaaatttaaaaatcatatttgtactcattcaattaattcgttgtttt 131  Q
    ||||||||||| | ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||  ||| ||||||| ||||||||||||||||    
36209757 tcatgccaattgtgttcaagaatattgacctagatagtcccttttcgtaagattaaatttaaaaatcatacatgtgctcattcgattaattcgttgtttt 36209658  T
132 gaacttcaaatt 143  Q
    ||||||||||||    
36209657 gaacttcaaatt 36209646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 36209611 - 36209557
Alignment:
152 caggcacatatcttgaaagagaaaggcaatgaaatagagctagttgataaaagat 206  Q
    |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||    
36209611 caggcacatatcttgaaagagaaaggaaatgaaatagagctagtagataaaagat 36209557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University