View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14222_low_26 (Length: 221)
Name: NF14222_low_26
Description: NF14222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14222_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 32 - 143
Target Start/End: Complemental strand, 36209757 - 36209646
Alignment:
| Q |
32 |
tcatgccaattttcttcaaaaatattgaccaagatagtcccttttcgtaagattaaatttaaaaatcatatttgtactcattcaattaattcgttgtttt |
131 |
Q |
| |
|
||||||||||| | ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
36209757 |
tcatgccaattgtgttcaagaatattgacctagatagtcccttttcgtaagattaaatttaaaaatcatacatgtgctcattcgattaattcgttgtttt |
36209658 |
T |
 |
| Q |
132 |
gaacttcaaatt |
143 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36209657 |
gaacttcaaatt |
36209646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 36209611 - 36209557
Alignment:
| Q |
152 |
caggcacatatcttgaaagagaaaggcaatgaaatagagctagttgataaaagat |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
36209611 |
caggcacatatcttgaaagagaaaggaaatgaaatagagctagtagataaaagat |
36209557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University