View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14223_high_21 (Length: 211)
Name: NF14223_high_21
Description: NF14223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14223_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 21830694 - 21830901
Alignment:
| Q |
1 |
ataacaatgctagtggctttaagattctctttattttcatctaatcccatacttccaagcaatcttcgtcttctttccgtgatggatcccggagcagcca |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
21830694 |
ataacaatgctagtagctttaagattctctttattttcatccaatcccatacttccaagcaatcttcgtcttctttctgtgatagatcccggagcagcca |
21830793 |
T |
|
| Q |
101 |
tccatatatcatagttaggagcaatgccggtagccgggggaagctccggcttccggtgtttggcagggtgaaatgaggagactgcagaggcaaaggataa |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21830794 |
tccatatatcatagtttggagcaatgccggtagccgggggaagctccggcttccggtgtttggaagggtgaaaggaggagactgcagaggcaaaggataa |
21830893 |
T |
|
| Q |
201 |
ccggctat |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
21830894 |
ccggctat |
21830901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University