View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14223_high_22 (Length: 202)
Name: NF14223_high_22
Description: NF14223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14223_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 31487099 - 31486927
Alignment:
| Q |
14 |
cacagaaccaccatgaccagtaaattaaaattaaacaacaaagaagaaatgatagacattgatcacaacttagaaaaacatattcacaaacagatgggat |
113 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31487099 |
cacaaaaccaccatgaccagtaaagtaaaattaaacaacaaagaagaaatgatagacattgatcacaacttagataaacatattcacaaacagatgggat |
31487000 |
T |
|
| Q |
114 |
gcatggctggtttgtttcaaatcttcgaccgtaaccattttctttctggcaaacgcatctacaacaacactaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31486999 |
gcatggctggtttgtttcaaatcttcgaccgtaaccattttctttctggcaaacgcatctacaacaacactaa |
31486927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University