View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14223_low_17 (Length: 262)
Name: NF14223_low_17
Description: NF14223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14223_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 15 - 247
Target Start/End: Complemental strand, 41595372 - 41595148
Alignment:
| Q |
15 |
aaacagagcacattcatttccattctcctccgccgccttaacaaatatccatcactcaaacaacatatcatagttagttcgggctcttcaactcaactca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41595372 |
aaacagagcacattcatttccattctcctccgccgccttaacaaatatccatcactcaaacaacatatcacagttagttcgggctcttcaactcaactca |
41595273 |
T |
 |
| Q |
115 |
agnnnnnnnnnnnnnnntatggaacataaaagtatattgatatcagctttgagtgttggtgttggagtaggagttggagttggaattggattagcgaatt |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41595272 |
a--------aaaaaaaatatggaacataaaagtatattgatatcagctttgagtgttggtgttggagtaggagttggagttggaattggattagcgaatt |
41595181 |
T |
 |
| Q |
215 |
ctggacaaaatgtttctaaatggggtcctaatt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41595180 |
ctggacaaaatgtttctaaatggggtcctaatt |
41595148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University