View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14223_low_20 (Length: 237)
Name: NF14223_low_20
Description: NF14223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14223_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 40979017 - 40978845
Alignment:
| Q |
15 |
atatgcagcatgtgattagggaatgattagaggacatgtgtaggat---tgacgtgcggaggcgtgctcgagtgtgatgtggtgcattgatattgatatg |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40979017 |
atatgcagcatgtgattagggaatggttagaggacatgtgtaagatgattgacgtacggaggcgtgctcgagtgtgatgtggtgcattgatattggtatg |
40978918 |
T |
 |
| Q |
112 |
tttcttcagacaatacgcctttgtgcgatggtcgtttggtcccaatataagattgaccttttgaccggtccag |
184 |
Q |
| |
|
|||||||||||| | ||||||||| || | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40978917 |
tttcttcagacactgcgcctttgtacggtagtcgtttggtcccagtataagattgaccttttgaccggtccag |
40978845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University