View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14223_low_24 (Length: 202)

Name: NF14223_low_24
Description: NF14223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14223_low_24
NF14223_low_24
[»] chr1 (1 HSPs)
chr1 (14-186)||(31486927-31487099)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 31487099 - 31486927
Alignment:
14 cacagaaccaccatgaccagtaaattaaaattaaacaacaaagaagaaatgatagacattgatcacaacttagaaaaacatattcacaaacagatgggat 113  Q
    |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
31487099 cacaaaaccaccatgaccagtaaagtaaaattaaacaacaaagaagaaatgatagacattgatcacaacttagataaacatattcacaaacagatgggat 31487000  T
114 gcatggctggtttgtttcaaatcttcgaccgtaaccattttctttctggcaaacgcatctacaacaacactaa 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31486999 gcatggctggtttgtttcaaatcttcgaccgtaaccattttctttctggcaaacgcatctacaacaacactaa 31486927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University