View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14224_high_3 (Length: 265)
Name: NF14224_high_3
Description: NF14224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14224_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 3 - 124
Target Start/End: Complemental strand, 55164807 - 55164686
Alignment:
| Q |
3 |
ttatttattattagggtttatctaataaataaataaatgagaatagcgagcgaaaaggcaaacctgtttatgggggatcttctggtgctcctgcttatgg |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55164807 |
ttatctattattagggtttatctaataaataaataaatgagaatagcgagcgaaaaggcaaacctgtttatgggggatcttctggtgctgctgcttatgg |
55164708 |
T |
 |
| Q |
103 |
ttgaaattgaaatgaaagagat |
124 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55164707 |
ttgaaattgaaatgaaagagat |
55164686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University