View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14224_low_8 (Length: 258)
Name: NF14224_low_8
Description: NF14224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14224_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 30855055 - 30854810
Alignment:
| Q |
7 |
gtatatgcctgcatctgtagtttgtttcaacatacatcgtaaaatacacgaaaaagaactaagagtgcagcctcctctatcaaatcacaacaacaataaa |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30855055 |
gtatatgcatgcatctgtagtttgtttcaacatacatcgtaaaatacacgaaaaagaactaagagtgcagcctcctctatcaaatcacaacaacaataaa |
30854956 |
T |
 |
| Q |
107 |
gttaaaattgcaatcacaaattatccttgttttacattttttattaggaaaaatatcaatatataatgaaaatatattcgtccacaagtctcggctaaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30854955 |
gttaaaattgcaatcacaaattatcctcgttttacattttttattaggaaaaatatcaatatataatgaaaatatattcgtccacaagtctcggctaaaa |
30854856 |
T |
 |
| Q |
207 |
tgagaaatatcccagaattgttaggtcgaacactataattacggtt |
252 |
Q |
| |
|
||| |||||| ||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
30854855 |
tgacaaatattccataattgttaggtcgaatactataattgcggtt |
30854810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University