View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14225_high_12 (Length: 324)
Name: NF14225_high_12
Description: NF14225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14225_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 315
Target Start/End: Complemental strand, 46825874 - 46825575
Alignment:
| Q |
16 |
ctttctactattgatacaagccaataattctaatcattttataggtcatgtatgtttcataatttacatgaataatttcttatttttgttttccatttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46825874 |
ctttctactattgatacaagccaataattctaatcattttataggttatgtatgtttcataatttacatgaataatttcttatttttgttttccatttct |
46825775 |
T |
 |
| Q |
116 |
tgacattttatcctcaagatcttgtcgtgtataattgtggttactatttctggtagcagacccggcataaattgtaccaatgcagagtggcaaatgtata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46825774 |
tgacattttatcctcaagatcttgtcgtgtatatttttggttactatttctggtagcagacccggcataaattgcaccaatgcagagtggcaaatgtata |
46825675 |
T |
 |
| Q |
216 |
ggaagactcaaagctccatcacttgccccataacattcttctcccccaaatactcaaaagtgccatcaactaccatccaatgaccaacctttggatgatg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46825674 |
ggaagactcaaagctccatcacttgccccatgacattcttctcccccaaacactcaaaagtgccatcaactaccatccaatgaccaacctttgtatgatg |
46825575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University