View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14225_high_15 (Length: 242)
Name: NF14225_high_15
Description: NF14225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14225_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 35071527 - 35071297
Alignment:
| Q |
1 |
tgagtgagggagttgagattatcgggaagggtaccggcaagcttttgatcggagaggtttatgctggtgacgcggttgtcggatgagcatttgacgccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071527 |
tgagtgagggagttgagattatcgggaagggttccggcgagcttttgatcggagaggtttatgctggtgacgcggttgtcggatgagcatttgacgccgg |
35071428 |
T |
|
| Q |
101 |
accattgacagaaggaagtattggaagaccagccgttaggagaaggtttaagggattgccgaaggctttgcatgacggtggcgtcatcgtcggccaccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35071427 |
accattgacagaaggaagtattggaagaccagccgttaggagaaggtttaagggattgccgaaggctttgcatgacggtgccgtcatcgtcggccaccac |
35071328 |
T |
|
| Q |
201 |
gaaggtggcggcgatgatcgcgatgatgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35071327 |
gaaggtggcggcgatgatcgcgatgatgatg |
35071297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University