View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14225_high_18 (Length: 237)
Name: NF14225_high_18
Description: NF14225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14225_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 38 - 109
Target Start/End: Complemental strand, 28075987 - 28075916
Alignment:
| Q |
38 |
aattaaattattgagaaacttcacagctagctagctagtcaagtcttgccattgatttaaggcttcagttat |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
28075987 |
aattaaattattcagaaacttcacagctacctagctagtcaagtcttttcattgatttaaagcttcacttat |
28075916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 38 - 109
Target Start/End: Complemental strand, 28172994 - 28172923
Alignment:
| Q |
38 |
aattaaattattgagaaacttcacagctagctagctagtcaagtcttgccattgatttaaggcttcagttat |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
28172994 |
aattaaattattcagaaacttcacagctacctagctagtcaagtcttttcattgatttaaagcttcacttat |
28172923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 58 - 110
Target Start/End: Complemental strand, 28155445 - 28155393
Alignment:
| Q |
58 |
tcacagctagctagctagtcaagtcttgccattgatttaaggcttcagttatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
28155445 |
tcacagctagctagctagtcaagtcttgtcgttgatttaaagcttcagttatt |
28155393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University