View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14225_low_13 (Length: 344)
Name: NF14225_low_13
Description: NF14225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14225_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 205 - 330
Target Start/End: Complemental strand, 46807767 - 46807642
Alignment:
| Q |
205 |
ctaacaacaaccctttcattcccttccccttctagggctaagaaacgaagctatgtaacaaagtataaaggtaccacggaagcatagtaacaatcctaaa |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46807767 |
ctaacaacaaccctttcattcccttccccttctagggctgagaaacgaagctatgtaacaaagtataaaggtaccatggaagcatagtaacaatcctaaa |
46807668 |
T |
 |
| Q |
305 |
tcaattgagtatttcataccaaaaag |
330 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46807667 |
tcaattgagtatttcataccaaaaag |
46807642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 38 - 177
Target Start/End: Complemental strand, 46807947 - 46807808
Alignment:
| Q |
38 |
atctaaagggtgataataccattcatnnnnnnngacaggttggactcactttnnnnnnntaaaaaccagttctagtataggttcttgatagaatctacaa |
137 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46807947 |
atctaaaaggtgataataccattcataaaaaaagacaggttggaatcactttccccccctaaaaaccagttctagtataggttcttgatagaatctacat |
46807848 |
T |
 |
| Q |
138 |
tcttcgccactttgaagactaagcgcagaaaatgtgatca |
177 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46807847 |
tcttcaccactttgaagactaagcgcagaaaatgtgatca |
46807808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University