View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14225_low_16 (Length: 260)
Name: NF14225_low_16
Description: NF14225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14225_low_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 41978249 - 41978498
Alignment:
| Q |
11 |
aagaatatcacattaatcagtcaatacagtgaatcttacacaagctgcaaagctgaagatgccaaactgtcaggtatagagccggttaactgattattgg |
110 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41978249 |
aagaaaatcacattaatcaatcaatacagtgaatcttacacaagctgcaaagctgaagatgccaaactgtcaggtatagagccggttaactgattattag |
41978348 |
T |
 |
| Q |
111 |
ataaatccctacagaaacattagagnnnnnnnnnnnnnnnnnnnnnnnntaatttaattaaattttccttctggtattacgaacagaacacatgcttcta |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978349 |
ataaatccctacagaaacattagagaaaaacaaaaagaatatcaaaaaataatttaattaaattttccttctggtattacgaacagaacacatgcttctg |
41978448 |
T |
 |
| Q |
211 |
tgcagatctcaacattgtgtgtaaaacaaaggcccatttattgagcaaca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978449 |
tgcagatctcaacattgtgtgtaaaacaaaggcccatttattgagcaaca |
41978498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University