View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14226_high_17 (Length: 221)
Name: NF14226_high_17
Description: NF14226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14226_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 5348813 - 5349003
Alignment:
| Q |
16 |
aaaataacaatatgtattggttcatcaaactctccaaaaagtaccaagaatatatcaaaattgtgatagtgtcttgcatatttaagaaccaaaattgttg |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5348813 |
aaaataacgatatgtattggttcatcaaactctccaaaaagtactaagaatatatcaaaattgtgataatgtcttgcatatttaagaaccaaaattgttg |
5348912 |
T |
 |
| Q |
116 |
tttactttagtaagaatgaagtgacaagctaaggaattgtttaccatcaaatcatggaactcaatccttcccttagaaggccatgaagatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5348913 |
tttactttagtaagaatgaagtgacaagctaaggaattgtttaccatcaaatcatggaactctatccttcccttagaaggccatgaagatg |
5349003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University