View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14226_low_14 (Length: 331)
Name: NF14226_low_14
Description: NF14226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14226_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 27641902 - 27641604
Alignment:
| Q |
16 |
actcgcaaatttttcatgactctaattggcatcccttcgggcacttttagaagtccatatgctacagctagtctttcactatgataacctaagctatgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27641902 |
actcgcaaatttttcatgactctaattggcatcccttcgggcacttttagaagtccatatgctacagctagtctttcactatgataacctaagctatgtg |
27641803 |
T |
|
| Q |
116 |
tcttctcttcctcatccacgtcatgaagcacaaagctaccatcgggacagtaaccagcttcccttaaaaacccacttagcttttccaacagttgtgtgat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27641802 |
tcttctcttcctcatccacgtcatgaagcacaaagctaccatcgggacagtaaccagcttcccttaaaaacccacttagcttttccaacatttgtgtgat |
27641703 |
T |
|
| Q |
216 |
catatgctgctcagggtggctcttgctgtctcccccggtgaacatatgcaccttcttctccacctcaatccaactacagccaggaaatttgatgactct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27641702 |
catatgctgctcagggtggctcttgctgtctcccccggtgaacatatgcaccttcttctccacctcaatccaactacagccaggaaatttgatgactct |
27641604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University