View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14226_low_15 (Length: 283)
Name: NF14226_low_15
Description: NF14226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14226_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 33841387 - 33841653
Alignment:
| Q |
1 |
agagtgagtcttagagaaaatgttggaaagacacggtttataacacacctccaaacaactcttttttcgtgaatttggtatctgtgtgcaactacggata |
100 |
Q |
| |
|
||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33841387 |
agagtgagttttagagaaagtgttggaaatacacggtttataacacacctccaaacaactcttttttcgtgaatttggtatctgtgtgcaactacggata |
33841486 |
T |
|
| Q |
101 |
ttaatcattctagttggataagaccgcaataagtggcaattggcaaagttttccttcaaaaaatttaacattgatgcattcatatgactagattcaaact |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33841487 |
ttaatcattcgagttggataagaccgcaataagtggcaattggcaaagttttccttcaaaagatttaacatttatgcattcatatgactagattcaaact |
33841586 |
T |
|
| Q |
201 |
cacaacatatggttaagtttaatgataatcattatcatcttatcaaatgctcctgggtgcttataaa |
267 |
Q |
| |
|
|| |||||||||||||||| || | |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33841587 |
cataacatatggttaagttgaaaaagaatcattatcatcttatcaaatgctcttgggtgcttataaa |
33841653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University