View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14226_low_16 (Length: 254)
Name: NF14226_low_16
Description: NF14226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14226_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 51739239 - 51739037
Alignment:
| Q |
1 |
tcctaaggacaacgttgaagaagtgtgagacaacaagaatacatgacacttgcatgcccattgagtatagagggttaactagttctttattacaaaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739239 |
tcctaaggacaacgttgaagaagtgtgagacaacaagaatacatgacacttgcatgcccattgagtatagagggttaactagttctttattacaaaacat |
51739140 |
T |
 |
| Q |
101 |
tttgtgtgtggcatccattgtgtgcatttaatgtgtttgtcaaaacttcaatcaataaattagacaaagaaaggaatctgatatgaaattttacgtttta |
200 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739139 |
tttgtgggtggcatccattgtgtggatttaatgtttttgtcaaaac-tcaatcaataaattagacaaagaaaggaatctgatatgaaattttacgtttta |
51739041 |
T |
 |
| Q |
201 |
acaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
51739040 |
acaa |
51739037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 10199669 - 10199570
Alignment:
| Q |
1 |
tcctaaggacaacgttgaagaagtgtgagacaacaagaatacatgacacttgcatgcccattgagtatagagggttaactagttctttattacaaaacat |
100 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| ||||| || |||||||||||| || || | ||||||||||| |
|
|
| T |
10199669 |
tcctaagaacaacgttgaagaagtgtgacacaacaagaatgcatgacacttgcatacccatagaacttagagggttaacaagatcatcgttacaaaacat |
10199570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University