View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14226_low_7 (Length: 455)
Name: NF14226_low_7
Description: NF14226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14226_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 6e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 239 - 398
Target Start/End: Complemental strand, 9770027 - 9769867
Alignment:
| Q |
239 |
cattcttttgttcaatgtgtgttacaattacaaattccgataattcctttttt-gttgggattggaatagctgaaaatgggtgaatggtcctcacaaaac |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9770027 |
cattcttttgttcaatgtgtgttacaattacaaattccgataattcctttttttgttgggattggaatagctgaaaatgggtgaatggtcctcacaaaac |
9769928 |
T |
 |
| Q |
338 |
attgtttttgtctttatgtacaaaagcaataaatgtgtatgtttgaactggtttggtgttt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9769927 |
attgtttttgtctttatgtacaaaagcaataaatgtgtatgtttgaactggtttggtgttt |
9769867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University