View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14227_high_18 (Length: 210)
Name: NF14227_high_18
Description: NF14227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14227_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 30099718 - 30099516
Alignment:
| Q |
1 |
ttgaggacctcctcttgctcccctctgtttattatcatattgtttattttttctttgttgttgttgtggttacctgcaccaacctacctgaacaatctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30099718 |
ttgaggacctcctcttgctcccctctgtttattatcatattgtttattttttctttgttgttgttgtggttacctgcaccaacctacctgaacaatctgt |
30099619 |
T |
 |
| Q |
101 |
cctttccactgtctggtacatgacc----ccttggttaaaacgtatgcagatgcgtttcattaatcatatccgaagtcgactattgctcatccacacagg |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30099618 |
cctttccactgtctggtacatgacccctaccttggttaaaacgtatgcagatgcatttcattaatcatatccgaagtcgactattgctcatccatacagg |
30099519 |
T |
 |
| Q |
197 |
ttc |
199 |
Q |
| |
|
||| |
|
|
| T |
30099518 |
ttc |
30099516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University