View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14228_high_14 (Length: 206)
Name: NF14228_high_14
Description: NF14228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14228_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 12673773 - 12673577
Alignment:
| Q |
1 |
aaaggttaagtttggtaaaaacctaatttttaagataacatctgatcatatttaagatccattggccacctatgataaggtagatccactgtttcactga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
12673773 |
aaaggttaagtttggtataaacctaatttttaagataatatctgattatatttaagatccattggccacctatgataaggtaggtccactgtttcagtga |
12673674 |
T |
 |
| Q |
101 |
gatcacgtttcagatatctaatacgaggtgtgagcggagtgtgctatgagtattagttgagatgtgatcttttataagtgatgattaaccttcatct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12673673 |
gatcacgtttcagatatctaatacgaggtgtgagcggagtgtgctacgagtattagttgagatgtgaccttttataagtgatgattaaccttcatct |
12673577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University