View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14228_high_8 (Length: 332)
Name: NF14228_high_8
Description: NF14228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14228_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 111 - 322
Target Start/End: Complemental strand, 34630588 - 34630383
Alignment:
| Q |
111 |
tttgataagatattttcgataagatacgtctaggtcacacaacctaaaatttcgatatataacgtctaggtcactcaacgtnnnnnnnnnnnnngaaaat |
210 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
34630588 |
tttgataagatatttttgataagata-gtctaggtcacacaacctaaaatttcgatacataacgtctaggtcacgcaacgtaaaaaaa------gaaaat |
34630496 |
T |
|
| Q |
211 |
acatcatgttggtgcatagcaattaatctcaataaaactatatttattttgcaaataagctatc-attaattacacaatttacgatgaaatttattgccc |
309 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630495 |
acatcatgtcggtgcatagcaattaatctcaataaaactatatttattttgcaaataagctatctattaattacacaatttacgatgaaatttattgccc |
34630396 |
T |
|
| Q |
310 |
agttttggttcat |
322 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34630395 |
agttttggttcat |
34630383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 48
Target Start/End: Complemental strand, 34630880 - 34630852
Alignment:
| Q |
20 |
atacgctctcaactaaaagtttaacttat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34630880 |
atacgctctcaactaaaagtttaacttat |
34630852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University