View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14228_high_9 (Length: 305)
Name: NF14228_high_9
Description: NF14228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14228_high_9 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 23349002 - 23348716
Alignment:
| Q |
1 |
aactaactgctgcaaaatcagttgcaaacatatctttttcttgaaattttcattgttttattcatctatatttccatctttttgtctcagactctggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23349002 |
aactaactgctgcaaaatcagttgcaaacatatctttttcttgaaattttcattgttttattcatctatatttccatctttttgtctcagactctggaga |
23348903 |
T |
 |
| Q |
101 |
agatcaagaaaagaaattctcaatctcatttaggtattctgaactgaaattcatatatagatagatatatacttagcaattattaatttatgatttttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23348902 |
agatcaagaaaagaaattctcaatctcatttaggtattctgaactgaaattcatatatagatagatatatacttagcaattattaatttatgatttttct |
23348803 |
T |
 |
| Q |
201 |
gttttgaaattttattgtgtgtagcacaagtggttattaaggaactttgcacaaaatggaagatcaagggaaagggaaagagcttatgg |
289 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23348802 |
gttttgaaattttatt--gtgtagcacaagtggttattaaggaactttgcacaaaatggaagatcaagggaaagggaaagagcttatgg |
23348716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 24 - 137
Target Start/End: Complemental strand, 39636409 - 39636296
Alignment:
| Q |
24 |
gcaaacatatctttttcttgaaattttcattgttttattcatctatatttccatctttttgtctcagactctggagaagatcaagaaaagaaattctcaa |
123 |
Q |
| |
|
|||| ||||| ||||||||||| | | ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
39636409 |
gcaaccatatatttttcttgaagtatacattgttttattcatctatatttccatctttttgtctcagaatcttgagaagatcaagaaaagaaattatcaa |
39636310 |
T |
 |
| Q |
124 |
tctcatttaggtat |
137 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39636309 |
tctcatttaggtat |
39636296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 135 - 280
Target Start/End: Complemental strand, 39636274 - 39636133
Alignment:
| Q |
135 |
tattctgaactgaaattcatatatagatagatatatacttagcaattattaatttatgatttttctgttttgaaattttattgtgtgtagcacaagtggt |
234 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||| ||||||||||| ||||| || | |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39636274 |
tattctgagctgaaatttatatattgatagata----cttagcaattaataattcatcacttttctgttttgaaattttatttagtgtagcacaagtggt |
39636179 |
T |
 |
| Q |
235 |
tattaaggaactttgcacaaaatggaagatcaagggaaagggaaag |
280 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39636178 |
gatcaaggaactttgtacaaaatggaagatcaagggaaagggaaag |
39636133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 203 - 289
Target Start/End: Original strand, 160049 - 160133
Alignment:
| Q |
203 |
tttgaaattttattgtgtgtagcacaagtggttattaaggaactttgcacaaaatggaagatcaagggaaagggaaagagcttatgg |
289 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
160049 |
tttgaaattttattgtg--tagcacaagtggtgattaaggaactttgcacaaaatggaagatcaagggaaagggtaagggcttatgg |
160133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University