View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14228_low_12 (Length: 265)
Name: NF14228_low_12
Description: NF14228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14228_low_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 265
Target Start/End: Complemental strand, 12674164 - 12673918
Alignment:
| Q |
20 |
caccagagactaaaatcaaatatggtggttagggttcaaggttttttgacctaattaagagtgtgttatgttgatgttgatgtcaagacaaactactaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12674164 |
caccagagactaaaatcaaatatggtggttagggtttaaggttttttgacctaattaagagtgtgttatgttgatgttgatgtcaagacaaactactaga |
12674065 |
T |
 |
| Q |
120 |
aaaagctaaatcaatgacaaaaatttatgaa-aaaatgtgaagttgatctctatttaatttcaatcatcaaatttaatgatgagtaaattagtgatgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12674064 |
aaaagctaaatcaatgacaaaaatttatgaaaaaaatgtgaagttgatctctatttaatttcaatcatcaaatttaatgatgagtaaattagtgatgaat |
12673965 |
T |
 |
| Q |
219 |
ttaannnnnnnctttctgtctacaatttgttagtaatgcaacttgtt |
265 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12673964 |
ttaatttttttctttctgtctacaatttgttagtaatgcaacttgtt |
12673918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University